Posted: Wed Mar 28, 2007 9:51 am
Maybe we're supposed to drop the repeating letters and decode what's left?
So RORKRKRCRRRK would become OKKCRK... I think...
So RORKRKRCRRRK would become OKKCRK... I think...
Forum to post messages about Bree and Danielbeast
http://lgpedia.nitemarecafe.com/forum/
Code: Select all
6(-3) 6(-1) 6(-3) 12(-8) 6(-3) 12(-8) 6(-3) 12(-0) 6(-3) 6(-2) 6(-3) 12(-8)
Isoleucine_Proline_Isoleucine_IsoleucineIs_Isoleucine...Aspartic_acid_Isoleucine_IsoleucineIso
^ ^ ^ ^ ^ ... ^ ^ ^
6 6 6 12 6 ... 6 6 12
UNUSUSUCUTUS
RMRKRKRCRRRK
Or using the alternative shifts:
6(-6) 6(-1) 6(-6) 12(-4) 6(-6) 12(-4) 6(-6) 12(-0) 6(-6) 6(-5) 6(-6) 12(-4)
UNUSUSUCUTUS
OMOOOOOCOOOO
The thing is, that result uses both shifts. In fact, his "fix" for the second letter doesn't affect the result! It only makes it more odd because another O gets decoded, but actually any other DNA sequence, with whatever choice of numbers to pick letters (the 6's and 12's), would result in 2 alternative codes that when decrypted against each other you'd get DADWDW (there seems to be a glitch in the antepenultimate letter). This is because those operations are the equivalent of taking the difference in the alternative (a b c d) responses and converting what you get through a=0, b=1, etc.TOSG wrote:Interesting.
And, at least we know that the shifts are correct now.
Code: Select all
3 1 3 8 3 8 3 0 3 2 3 8 (track numbers as they appear in the lyrics file)
6 1 6 4 6 4 6 0 6 5 6 4 (track numbers as they appear in the MP3 files )
3 0 3 -4 3 -4 3 0 3 3 3 -4 (difference)
d a d w d w d a d d d w (a=0, d=3, w=-4)
So, back to square 1, I guess.From: TravelerJ19 [videos (9) | favorites (0) | friends (0)]
Sent: March 28, 2007
Subject: Re: Re: 6 and 12
Message:
That is an interesting result, but not what I'm going for. That first gibberish you sent me means nothing. Stick with your O's. Maybe you'll see something that looks out of place.
DeagolTheStoor wrote:
> Well I got the impression your previous message was confirming those shifts instead of the mp3 ones.
> So, I used one result as a key to decode the other, and got this:
>
> DADWDWDADDDW
>
> Are you saying Walter is your dad?
>
Code: Select all
6(-6) 6(+1) 6(-6) 12(-4) 6(-6) 12(-4) 6(-6) 12(-0) 6(-6) 6(-5) 6(-6) 12(-4)
U N U S U S U C U T U S
-6 +1 -6 -4 -6 -4 -6 -0 -6 -5 -6 -4
O O O O O O O C O O O O
Using "StopOchre" gets the desired "OOOOOOOOOOOO" result.deagol wrote:I'm tired of taking screencaps...
So, back to square 1, I guess.From: TravelerJ19 [videos (9) | favorites (0) | friends (0)]
Sent: March 28, 2007
Subject: Re: Re: 6 and 12
Message:
That is an interesting result, but not what I'm going for. That first gibberish you sent me means nothing. Stick with your O's. Maybe you'll see something that looks out of place.
DeagolTheStoor wrote:
> Well I got the impression your previous message was confirming those shifts instead of the mp3 ones.
> So, I used one result as a key to decode the other, and got this:
>
> DADWDWDADDDW
>
> Are you saying Walter is your dad?
>What looks out of place is that C (it came from the 12th letter in OchreOchreOchre). In order to fix it, it would have to be an O. Maybe it should've been the 11th letter, or the 6th, or the 1st. Or I could keep the 12th letter C, but change that odd (-0) shift, where I would need a (+12) to get an O. Or perhaps I should've used Stop and it'd be the 3rd, 7th, or 11th letter. Or if I kept the 12th letter, a P, It'd require a (-1) shift. Or maybe he just wants me to fix that codon so an O comes out? Even then, I don't know what's the point of getting all O's. I think this puzzle sucks.Code: Select all
6(-6) 6(+1) 6(-6) 12(-4) 6(-6) 12(-4) 6(-6) 12(-0) 6(-6) 6(-5) 6(-6) 12(-4) U N U S U S U C U T U S -6 +1 -6 -4 -6 -4 -6 -0 -6 -5 -6 -4 O O O O O O O C O O O O
To: TravelerJ19 [videos (9) | favorites (0) | friends (0)]
Sent: March 28, 2007
Read: —
Subject: Re: Re: Re: Re: Re: 6 and 12
Message:
Ok, so I've been working with ALL those decoding numbers remapped to the MP3 files track numbers, including the 6 and 12. Track 6 is #7 in the MP3, and track 12 is #3. This gives me the following decoding numbers:
7(-6) 7(+1) 7(-6) 3(-4) 7(-6) 3(-4) 7(-6) 3(-0) 7(-6) 7(-5) 7(-6) 3(-4)
Reapplying it to the aminoacid chain, I get:
CECOCOCoCICO which shifts into WFWKWKWoWDWK
I'm using a lower case 'o' for that StopOchre which I'm not sure I'm doing right. I still don't see anything meaningful, so then I tried reading that as a new amino chain, and ran it through BOTH decoding sets of numbers (just in case).
Using the remapped numbers 7(-6) 7(+1) 7(-6) 3(-4) 7(-6) 3(-4) 7(-6) 3(-0) 7(-6) 7(-5) 7(-6) 3(-4) I get PAPSPSPoPIPS which shifts into JBJOJOJoJDJO.
Using the original numbers 6(-3) 6(+1) 6(-3) 12(-8 ) 6(-3) 12(-8 ) 6(-3) 12(-0) 6(-3) 6(-2) 6(-3) 12(-8 ) I get OLOEOEOoOTOE which shifts into LMLWLWLoLRLW.
I even tried the numbers that got me all O's before (6 and 12 but with MP3 shifts), and OLOEOEOoOTOE shifted into IMIAIAIoIOIA. To be thorough, I thought why not do the last possible combination, 7 and 3 with lyrics shifts. This shifted PAPSPSPoPIPS into MBMKMKMoMGMK.
Sorry, but I'm about to give up on this. I can't even take care of what Walter left you since I'm not in the US. I'm just trying to help some friends. Hopefully they'll be able to pick up from where I left.
TravelerJ19 wrote:
> You're right, that C does look wrong. Something else I gave you doesn't seem to make sense, either.
> Maybe you can fix both of these.
>
> > DeagolTheStoor wrote:
> >
> > Ah well alright... although it would fit the way that Walter talks about you if he were your father, haha.
> >
> > So, what's out of place is that C, which came from that "stop" codon, which I interpreted as Ochre (Walter
> > used it in a previous message). I had to pick the 12th letter in OchreOchreOchre (from your Looperama
> > hint). So, how do I fix it? Should I make it an O? and if so, what then? I get all O's, so? That still leads me
> > nowhere.
I'm expecting to get the answer (b). Note the sneaky Tachy reference, looking to see if TJ19 is au fait with the Plucky Underdog Resistance. Oh, and the gratiutious Ealing Comedy sign-off for good measure.ignatzmouse15 wrote:Hi Traveler,
Deagol appears to be taking a little R&R right now, so I thought I'd fill you in on our current progress.
Using the shifts:
6(-6) 6(+1) 6(-6) 12(-4) 6(-6) 12(-4) 6(-6) 12(-0) 6(-6) 6(-5) 6(-6) 12(-4)
and applying them to the amino acids:
Isoleucine
Proline
Isoleucine
IsoleucineIsoleucine
Isoleucine
IsoleucineIsoleucine
Isoleucine
StopOchreStopOchre
Isoleucine
AsparticAcid
Isoleucine
IsoleucineIsoleucine
gets us:
OOOOOOOOOOOO
Very Scooby Doo. If this is a clue for a word, I'd guess "(12 O) Clock". Better would be a Jeapordy question "What time is it?"
Is this
a) Bingo!
b) Nearly there.
c) I wouldn't start from here if I were you.
Please pass on my regards to Walter.
Pip pip,
I.M.
So the OOOOOOOCOOOO is deliberate, and it's Ochre, not StopOchre (OK, that was a bit of a straw-clutch). O to C is a -12 shift, hmm another 12.TravelerJ19 wrote:I'm not as good as Walter at numbers, but when I count 12 into Ochre, I get "C." I'd say that's also a good answer to your question. A better question would be, "Why isn't the last 'O' with his friends, and who did he get to replace him?" You have all you need in the letters you've decoded and the numbers you used to get there.
ignatzmouse15 wrote:
> Hi Traveler,
>
> Deagol appears to be taking a little R&R right now, so I thought I'd f...
Could this maybe be a movie or book reference or something? like could we get the answer from a movie or book? (ok maybe that is a stretch but I guess you never know).Why isn't the last 'O' with his friends, and who did he get to replace him?
That was a short vacationdeagol wrote:He also told me all the decoding numbers are right the way we have them. So I'm guessing the only thing left to try is the DNA.
I found that the only way to get an O from the 12th character is in Tyrosine (Y), which can come from TAC or TAT codons. The original Ochre was TAA.
So, change that A for a C or a T... ACT? the original DNA would become ATTCCTATCATTATAATCATATACATTGATATCATA or ATTCCTATCATTATAATCATATATATTGATATCATA.
And I'm stuck again. Oh and thanks mouse, for taking over so efficiently.
Code: Select all
6(0) 6(7) 6(0) 12(8) 6(0) 12(8) 6(0) 12(12) 6(0) 6(1) 6(0) 12(8)Code: Select all
UUUAUAUOUUUACode: Select all
UUUAUAUCUUUACode: Select all
12(-4) 12(-4) 12(-0) 12(-4)Code: Select all
JOEEYou lost me on that one. What parts are you adding together?ignatzmouse wrote: You can get O by replacing 12(0) by 12(12), so adding the first part of the index to the second gives:Code: Select all
6(0) 6(7) 6(0) 12(8) 6(0) 12(8) 6(0) 12(12) 6(0) 6(1) 6(0) 12(8)